Browse wiki
Sequence 15 (LZR-2 , LZR2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Design | SiRNA + |
Name | LZR-2 , LZR2 + |
Sequence | siRNA sense (21b) CCAACAGTAGACCTGGTAGTT / siRNA antisense (21b) CTACCAGGTCTACTGTTGGTT |
Target | 5?-UTR ( HRV-16 ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:18:24 + |
hide properties that link here |
No properties link to this page. |