Browse wiki
| Sequence 168 (SP-1117 , SP1117) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Alkaline phosphatase, placental ( Regan isozyme ) Ensembl: ENSG00000163283 UniGene: Hs.284255 EntrezGene: 250 Ensembl Chr2: 232951592 - 232955841 Strand: 1 GO terms: 0000287 0004035 0008152 0008270 0009986 0016020 0016021 0016787 0048503 |
| Design | SiRNA + |
| Name | SP-1117 , SP1117 + |
| Sequence | siRNA sense (21b) TGTTCGACGACGCCATTGATT / siRNA antisense (21b) TCAATGGCGTCGTCGAACATT |
| Target | ALPP ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:27 + |
| hide properties that link here |
| No properties link to this page. |
