Browse wiki
Sequence 194 (AbPP) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Amyloid beta ( A4 ) precursor protein ( pe … Amyloid beta ( A4 ) precursor protein ( peptidase nexin-II, Alzheimer disease ) Ensembl: ENSG00000142192 UniGene: Hs.434980 EntrezGene: 351 Ensembl Chr21: 26174733 - 26465003 Strand: -1 GO terms: 0004867 0005488 0005506 0005507 0005576 0005887 0005905 0006878 0006897 0006915 0007155 0007219 0008201 0008270 0009986 0016020 0016021 0042802 0046872 005090586 0016020 0016021 0042802 0046872 0050905 |
Design | SiRNA + |
Name | AbPP + |
Sequence | siRNA sense (21b) CTTGCATGACTACGGCATGTT / siRNA antisense (21b) CATGCCGTAGTCATGCAAGTT |
Target | APP ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:07 + |
hide properties that link here |
No properties link to this page. |