Browse wiki
Sequence 266 (BAG393) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | BCL2-associated athanogene Ensembl: ENSG00000081014 UniGene: Hs.377484 EntrezGene: 573 Ensembl Chr15: 48988238 - 49085389 Strand: 1 GO terms: 0005198 0005515 0005794 0005905 0006461 0006886 0008565 0016020 0016192 0030117 0030126 |
Design | SiRNA + |
Name | BAG393 + |
Sequence | siRNA sense (21b) GCTCTCTGCAAACTTGATATT / siRNA antisense (21b) TATCAAGTTTGCAGAGAGCTT |
Target | BAG1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:30 + |
hide properties that link here |
No properties link to this page. |