Browse wiki
| Sequence 296 (si 086) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | BCL2-like 1 Ensembl: ENSG00000084234 UniG … BCL2-like 1 Ensembl: ENSG00000084234 UniGene: Hs.516966 EntrezGene: 598 Ensembl Chr11: 129445011 - 129519910 Strand: 1 GO terms: 0001967 0003677 0004867 0005488 0005515 0005634 0006878 0007186 0007617 0007626 0009790 0016020 0016021 0030198 0030900 0030901 0042309 0050825 0050826 005088500 0030901 0042309 0050825 0050826 0050885 |
| Design | SiRNA + |
| Name | si_086 + |
| Sequence | siRNA sense (21b) CGACCTGTGATACAAAAGATC / siRNA antisense (21b) TCTTTTGTATCACAGGTCGGG |
| Target | BCL2L1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:31 + |
| hide properties that link here |
| No properties link to this page. |
