Browse wiki
| Sequence 308 (hBub1 1 , hBub11) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | BUB1 budding uninhibited by benzimidazoles … BUB1 budding uninhibited by benzimidazoles 1 homolog ( yeast ) Ensembl: ENSG00000169679 UniGene: Hs.469649 EntrezGene: 699 Ensembl Chr2: 111111883 - 111152135 Strand: -1 GO terms: 0000166 0000776 0004672 0004674 0005524 0005634 0005816 0006468 0007049 0007067 0007094 0008283 0016740 005130149 0007067 0007094 0008283 0016740 0051301 |
| Design | SiRNA + |
| Name | hBub1_1 , hBub11 + |
| Sequence | siRNA sense (21b) CCAGGCTGAACCCAGAGAGTT / siRNA antisense (21b) CTCTCTGGGTTCAGCCTGGTT |
| Target | BUB1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:33 + |
| hide properties that link here |
| No properties link to this page. |
