Browse wiki
Sequence 32 (ISIS-190401 , ISIS 190401) |
Application | Gene silencing + |
---|---|
Chemistry | MoG*moC*moG*moG*moT*C*A*G*C*G*A*T*C*C*C*moA*moG*moG*moG*moT + |
Description | Actin, alpha 1 , skeletal muscle Ensembl: … Actin, alpha 1 , skeletal muscle Ensembl: ENSG00000143632 UniGene: Hs.1288 EntrezGene: 58 Ensembl Chr1: 227633615 - 227636468 Strand: -1 GO terms: 0000166 0001725 0004618 0005198 0005200 0005515 0005524 0005737 0005856 0005865 0005884 0006096 0006936 0017022 0030240 0043531 004874196 0006936 0017022 0030240 0043531 0048741 |
Design | MOE gapmer + |
Name | ISIS-190401 , ISIS 190401 + |
Sequence | GCGGTCAGCGATCCCAGGGT |
Target | ACTA1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:35 + |
hide properties that link here |
No properties link to this page. |