Browse wiki
| Sequence 33 (ISIS-190403 , ISIS 190403) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoG*moG*moG*moA*moA*G*C*G*A*G*G*C*T*T*C*moA*moC*moT*moT*moG + |
| Description | Actin, alpha 1 , skeletal muscle Ensembl: … Actin, alpha 1 , skeletal muscle Ensembl: ENSG00000143632 UniGene: Hs.1288 EntrezGene: 58 Ensembl Chr1: 227633615 - 227636468 Strand: -1 GO terms: 0000166 0001725 0004618 0005198 0005200 0005515 0005524 0005737 0005856 0005865 0005884 0006096 0006936 0017022 0030240 0043531 004874196 0006936 0017022 0030240 0043531 0048741 |
| Design | MOE gapmer + |
| Name | ISIS-190403 , ISIS 190403 + |
| Sequence | GGGAAGCGAGGCTTCACTTG |
| Target | ACTA1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:18:26 + |
| hide properties that link here |
| No properties link to this page. |
