Browse wiki
| Sequence 331 () |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Cyclin T1 Ensembl: ENSG00000129315 UniGene: Hs.279906 EntrezGene: 904 Ensembl Chr12: 47373019 - 47397048 Strand: -1 GO terms: 0000074 0000079 0003677 0005515 0005634 0005730 0006355 0006366 0006468 0007049 0017069 0019901 0045449 0051301 |
| Design | ShRNA + |
| Sequence | (49b) GCCAAGAGTACTAAATCCTTTCAAGAGAAGGATTTAGTACTCTTGGCTT |
| Target | CCNT1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:29 + |
| hide properties that link here |
| No properties link to this page. |
