Browse wiki
Sequence 331 () |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Cyclin T1 Ensembl: ENSG00000129315 UniGene: Hs.279906 EntrezGene: 904 Ensembl Chr12: 47373019 - 47397048 Strand: -1 GO terms: 0000074 0000079 0003677 0005515 0005634 0005730 0006355 0006366 0006468 0007049 0017069 0019901 0045449 0051301 |
Design | ShRNA + |
Sequence | (49b) GCCAAGAGTACTAAATCCTTTCAAGAGAAGGATTTAGTACTCTTGGCTT |
Target | CCNT1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:29 + |
hide properties that link here |
No properties link to this page. |