Browse wiki

Jump to: navigation, search
Sequence 356 (p14ARF
Application Gene silencing +
Chemistry RNA +
Description Cyclin-dependent kinase inhibitor 2A ( melanoma, p16, inhibits CDK4 ) Ensembl: ENSG00000100739
Design ShRNA +
Name p14ARF#1  +
Sequence (49b) GAACATGGTGCGCAGGTTCTTCAAGAGAGAACCTGCGCACCATGTTCTT
Target CDKN2A ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:31  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders