Browse wiki
| Sequence 375 (Cidea) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Cell death-inducing DFFA-like effector a Ensembl: ENSG00000176194 UniGene: Hs.249129 EntrezGene: 1149 |
| Design | Primer set + |
| Name | Cidea + |
| Sequence | Forward PCR primer (20b) GGGATCACAGACTAAGCGAG / Reverse PCR primer (18b) TGACGAGGGCATCCAGAG |
| Target | CIDEA ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:35 + |
| hide properties that link here |
| No properties link to this page. |
