Browse wiki
Sequence 384 (FP1466) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Colony stimulating factor 2 receptor, beta … Colony stimulating factor 2 receptor, beta, low-affinity ( granulocyte-macrophage ) Ensembl: ENSG00000100368 UniGene: Hs.592192 EntrezGene: 1439 Ensembl Chr22: 35648168 - 35664764 Strand: 1 GO terms: 0004872 0004896 0004907 0004912 0004914 0007165 0007585 0016020 0016021 0019221 003052665 0007585 0016020 0016021 0019221 0030526 |
Design | ShRNA + |
Name | FP1466 + |
Sequence | (65b) GATCCCCCCCCAGCAAGAGCCACCTGTTCAAGAGACAGGTGGCTCTTGCTGGGGTTTTTTGGAAG |
Target | CSF2RB ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:40 + |
hide properties that link here |
No properties link to this page. |