Browse wiki
| Sequence 390 (Csk839) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Tyrosine-protein kinase Ensembl: ENSG0000 … Tyrosine-protein kinase Ensembl: ENSG00000103653 UniGene: Hs.77793 EntrezGene: 2444 Ensembl Chr15: 72861768 - 72882557 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004713 0005515 0005524 0005737 0005886 0005911 0006468 0007242 0008022 0008285 001674011 0006468 0007242 0008022 0008285 0016740 |
| Design | SiRNA + |
| Name | Csk839 + |
| Sequence | siRNA sense (21b) GAGGTGTACTTTGAGAACCTC / siRNA antisense (21b) GGTTCTCAAAGTACACCTCCT |
| Target | CSK ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:02 + |
| hide properties that link here |
| No properties link to this page. |
