Browse wiki
| Sequence 412 (si 043) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Casein kinase 2, alpha prime polypeptide … Casein kinase 2, alpha prime polypeptide Ensembl: ENSG00000134072 UniGene: Hs.82201 EntrezGene: 1459 Ensembl Chr3: 9774026 - 9786661 Strand: -1 GO terms: 0000166 0004672 0004674 0004713 0005516 0005524 0005634 0005737 0006468 0006913 0007165 0007275 0007399 0016740 003015413 0007165 0007275 0007399 0016740 0030154 |
| Design | SiRNA + |
| Name | si_043 + |
| Sequence | siRNA sense (21b) GCTCAGGAGTACAATGTTCGT / siRNA antisense (21b) GAACATTGTACTCCTGAGCAG |
| Target | CSNK2A2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:05 + |
| hide properties that link here |
| No properties link to this page. |
