Browse wiki

Jump to: navigation, search
Sequence 445 (Daxx)
Application Gene silencing +
Chemistry RNA +
Design ShRNA +
Name Daxx  +
Sequence (49b) GGAGTTGGATCTCTCAGAATTCAAGAGATTCTGAGAGATCCAACTCCTT
Target DAXX ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:05  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders