Browse wiki
| Sequence 460 (Drisapersen , PRO051 , PRO-051, GSK2402968) |
| Application | Exon skipping + |
|---|---|
| Chemistry | MeU*meC*meA*meA*meG*meG*meA*meA*meG*meA*meU*meG*meG*meC*meA*meU*meU*meU*meC*meU + |
| Description | Dystrophin ( muscular dystrophy , Duchenne and Becker types ) Ensembl: ENSG00000079112 |
| Design | 2'-O-methyl phosphorothioate + |
| Name | Drisapersen , PRO051 , PRO-051, GSK2402968 + |
| Sequence | TCAAGGAAGATGGCATTTCT |
| Target | DMD ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 4 March 2015 01:07:49 + |
| hide properties that link here |
| No properties link to this page. |
