Browse wiki
| Sequence 48 (X-152 , X152) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Argonaute RISC catalytic component 2 Ensembl: ENSRNOG00000008533 UniGene: Rn.35512 EntrezGene: 59117 Ensembl Chr7: 110827857 - 110865589 Strand: -1 GO terms: 0003743 0005515 0006412 |
| Design | SiRNA + |
| Name | X-152 , X152 + |
| Sequence | siRNA sense (21b) TGGACATCCCCAAAATTGATT / siRNA antisense (21b) TCAATTTTGGGGATGTCCATT |
| Target | Ago2 ( Rattus norvegicus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:31 + |
| hide properties that link here |
| No properties link to this page. |
