Browse wiki
| Sequence 522 (fas 2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Fas ( TNF receptor superfamily member 6 ) … Fas ( TNF receptor superfamily member 6 ) Ensembl: ENSMUSG00000024778 UniGene: Mm.1626 EntrezGene: 14102 Ensembl Chr19: 34365156 - 34402260 Strand: 1 GO terms: 0004872 0004888 0005515 0006915 0006924 0006925 0006927 0006955 0007165 0008625 0009897 0016020 0016021 0043065 004506025 0009897 0016020 0016021 0043065 0045060 |
| Design | SiRNA + |
| Name | fas_2 + |
| Sequence | siRNA sense (21b) AGCCGAATGTCGCAGAACCTT / siRNA antisense (21b) GGTTCTGCGACATTCGGCTTT |
| Target | Fas ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:27 + |
| hide properties that link here |
| No properties link to this page. |
