Browse wiki
| Sequence 557 (ISIS MkHu ASO) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoC*moG*moA*moG*moA*C*A*G*T*C*G*C*T*T*C*moC*moA*moC*moT*moT + |
| Description | Huntingtin ( Huntington disease ) Ensembl … Huntingtin ( Huntington disease ) Ensembl: ENSG00000197386 UniGene: Hs.518450 EntrezGene: 3064 Ensembl Chr4: 3046206 - 3215485 Strand: 1 GO terms: 0003714 0005215 0005246 0005515 0005625 0005634 0005737 0005794 0006915 0006916 0006917 0007610 0008017 0009405 0009887 0009952 0016023 0016234 0047496 004834187 0009952 0016023 0016234 0047496 0048341 |
| Design | MOE gapmer + |
| Name | ISIS MkHu ASO + |
| Sequence | CGAGACAGTCGCTTCCACTT |
| Target | HTT ( Homo sapiens / Macaca mulatta ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:59 + |
| hide properties that link here |
| No properties link to this page. |
