Browse wiki
| Sequence 583 (si 123) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Histone deacetylase 6 Ensembl: ENSG000000 … Histone deacetylase 6 Ensembl: ENSG00000094631 UniGene: Hs.6764 EntrezGene: 10013 Ensembl ChrX: 48545170 - 48568336 Strand: 1 GO terms: 0000118 0000209 0003779 0004407 0005515 0005634 0005737 0005874 0006350 0006355 0006476 0007026 0007049 0007275 0008270 0016566 0016568 0016575 0016787 0042826 0042903 004687268 0016575 0016787 0042826 0042903 0046872 |
| Design | SiRNA + |
| Name | si_123 + |
| Sequence | siRNA sense (21b) CGAGCTGATCCAAACTCCTCT / siRNA antisense (21b) AGGAGTTTGGATCAGCTCGGT |
| Target | HDAC6 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:19 + |
| hide properties that link here |
| No properties link to this page. |
