Browse wiki
Sequence 587 (HDAC8 |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Histone deacetylase 8 Ensembl: ENSG00000147099 UniGene: Hs.310536 EntrezGene: 55869 Ensembl ChrX: 71466091 - 71709623 Strand: -1 GO terms: 0000118 0000122 0000228 0004407 0005634 0005737 0006333 0006350 0006355 0008134 0016568 0016575 0016787 |
Design | SiRNA + |
Name | HDAC8#2 + |
Sequence | siRNA sense (21b) ACGGGCCAGTATGGTGCATTT / siRNA antisense (21b) ATGCACCATACTGGCCCGTTT |
Target | HDAC8 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:44 + |
hide properties that link here |
No properties link to this page. |