Browse wiki
| Sequence 613 (si 008) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Hypoxia-inducible factor 1, alpha subunit … Hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) Ensembl: ENSG00000100644 UniGene: Hs.597216 EntrezGene: 3091 Ensembl Chr14: 61231992 - 61284729 Strand: 1 GO terms: 0001666 0003700 0003705 0004871 0005515 0005634 0005737 0006355 0007165 0030528 0035035 0042592 0045449 0045941 004698228 0035035 0042592 0045449 0045941 0046982 |
| Design | SiRNA + |
| Name | si_008 + |
| Sequence | siRNA sense (21b) CTCACCCAACGAAAAATTACA / siRNA antisense (21b) TAATTTTTCGTTGGGTGAGGG |
| Target | HIF1A ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:17 + |
| hide properties that link here |
| No properties link to this page. |
