Browse wiki
Sequence 721 (M-480 , M480) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Design | SiRNA + |
Name | M-480 , M480 + |
Sequence | siRNA sense (21b) CAGATTGCTGACTCCCAGCTT / siRNA antisense (21b) GCTGGGAGTCAGCAATCTGTT |
Target | Matrix protein 2 (M2) and matrix protein 1 (M1) genes ( AY619959.1 ) ( Influenza A virus (A / swine / Saskatchewan / 18789 / 02( H1N1 )) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:46 + |
hide properties that link here |
No properties link to this page. |