Browse wiki

Jump to: navigation, search
Sequence 724 (VIP17 1)
Application Gene silencing +
Chemistry RNA +
Design ShRNA +
Name VIP17_1  +
Sequence (74b) AGATCTCCGCTCTTCATCTTCGAGTTTATTTCAAGAGAATAAACTCGAAGATGAAGAGCTTTTTGGAAAAGCTT
Target MAL ( Canis lupus familiaris ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:46  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders