Browse wiki
| Sequence 729 (ISIS-399462 , ISIS 399462) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoG*moG*moG*moT*moC*A*G*C*T*G*C*C*A*A*T*moG*moC*moT*moA*moG + |
| Description | Metastasis associated lung adenocarcinoma transcript 1 ( non-coding RNA ) Ensembl: ENSMUSG00000092341 UniGene: Mm.298256 EntrezGene: 72289 |
| Design | MOE gapmer + |
| Name | ISIS-399462 , ISIS 399462 + |
| Sequence | GGGTCAGCTGCCAATGCTAG |
| Target | Malat1 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:31 + |
| hide properties that link here |
| No properties link to this page. |
