Browse wiki
Sequence 732 (siMEK1-2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Mitogen-activated protein kinase kinase 1 … Mitogen-activated protein kinase kinase 1 Ensembl: ENSG00000169032 UniGene: Hs.145442 EntrezGene: 5604 Ensembl Chr15: 64466674 - 64570935 Strand: 1 GO terms: 0000166 0004672 0004674 0004708 0004713 0005515 0005524 0005794 0005829 0006468 0006928 0006935 0006979 0007067 0007165 0008283 0016740 0030182 0030216 005138465 0008283 0016740 0030182 0030216 0051384 |
Design | SiRNA + |
Name | siMEK1-2 + |
Sequence | siRNA sense (21b) GTCCTGAAGAAAGCTGGAATT / siRNA antisense (21b) TTCCAGCTTTCTTCAGGACTT |
Target | MAP2K1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:31 + |
hide properties that link here |
No properties link to this page. |