Browse wiki
| Sequence 733 (shMEK1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Mitogen-activated protein kinase kinase 1 … Mitogen-activated protein kinase kinase 1 Ensembl: ENSG00000169032 UniGene: Hs.145442 EntrezGene: 5604 Ensembl Chr15: 64466674 - 64570935 Strand: 1 GO terms: 0000166 0004672 0004674 0004708 0004713 0005515 0005524 0005794 0005829 0006468 0006928 0006935 0006979 0007067 0007165 0008283 0016740 0030182 0030216 005138465 0008283 0016740 0030182 0030216 0051384 |
| Design | ShRNA + |
| Name | shMEK1 + |
| Sequence | (64b) GATCCCGCAACTCATGGTTCATGCTTTCAAGAGAAGCATGAACCATGAGTTGCTTTTTTGGAAA |
| Target | MAP2K1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:20 + |
| hide properties that link here |
| No properties link to this page. |
