Browse wiki
| Sequence 745 (M1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Mitogen-activated protein kinase 12 Ensem … Mitogen-activated protein kinase 12 Ensembl: ENSG00000188130 UniGene: Hs.432642 EntrezGene: 6300 Ensembl Chr22: 49033459 - 49042312 Strand: -1 GO terms: 0000166 0000287 0004672 0004674 0004707 0004713 0005515 0005524 0005737 0005739 0006468 0006975 0007049 0007050 0007165 0007517 0016740 004544549 0007050 0007165 0007517 0016740 0045445 |
| Design | SiRNA + |
| Name | M1 + |
| Sequence | siRNA sense (20b) GAATGTCTGAGGAGTCTTTT / siRNA antisense (20b) AAGACTCCTCAGACATTCTT |
| Target | MAPK12 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:18 + |
| hide properties that link here |
| No properties link to this page. |
