Browse wiki

Jump to: navigation, search
Sequence 75 (CLSTR05869r1 ciad039h11 132)
Application Gene silencing +
Chemistry PmGpmApmApmApmTpmCpmCpmTpmGpmGpmTpmTpmTpmCpmTpmCpmTpmTpmTpmApmCpmCpmCpmApmT +
Design Morpholino +
Name CLSTR05869r1_ciad039h11_132  +
Sequence (25b) GAAATCCTGGTTTCTCTTTACCCAT
Target AK113987 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:35  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-2075-20(CLSTR05869r1-20ciad039h11-20132)"