Browse wiki
| Sequence 760 (pEg3-2 , pEg32) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Maternal embryonic leucine zipper kinase Ensembl: ENSG00000165304 UniGene: Hs.184339 EntrezGene: 9833 Ensembl Chr9: 36562873 - 36667678 Strand: 1 GO terms: 0000166 0004672 0004674 0004713 0005524 0005737 0006468 0016740 |
| Design | SiRNA + |
| Name | pEg3-2 , pEg32 + |
| Sequence | siRNA sense (21b) CGGAGATTGAGGCCTTGAATT / siRNA antisense (21b) TTCAAGGCCTCAATCTCCGTT |
| Target | MELK ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:44 + |
| hide properties that link here |
| No properties link to this page. |
