Browse wiki
| Sequence 761 (MEN1-3) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Multiple endocrine neoplasia I Ensembl: ENSG00000133895 UniGene: Hs.423348 EntrezGene: 4221 Ensembl Chr11: 64327564 - 64335342 Strand: -1 GO terms: 0000122 0003677 0005515 0005634 0005829 0006355 0016571 0030528 0032154 0035097 0045941 |
| Design | SiRNA + |
| Name | MEN1-3 + |
| Sequence | siRNA sense (22b) CACCTTTCTTGTGCAGTCCCTA / siRNA antisense (22b) GGGACTGCACAAGAAAGGTGCC |
| Target | MEN1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:19 + |
| hide properties that link here |
| No properties link to this page. |
