Browse wiki

Jump to: navigation, search
Sequence 769 (miR-106 , miR106)
Application Gene silencing +
Chemistry PmGpmCpmTpmApmCpmCpmTpmGpmCpmApmCpmTpmGpmTpmApmApmGpmCpmApmCpmTpmTpmTpmT +
Description miR106
Design Morpholino +
Name miR-106 , miR106  +
Sequence (24b) GCTACCTGCACTGTAAGCACTTTT
Target MiR-106 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:57  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders