Browse wiki

Jump to: navigation, search
Sequence 865 (MO miR-30c non overlapping loop)
Application Gene silencing +
Chemistry PmApmCpmTpmCpmCpmCpmGpmGpmCpmCpmTpmCpmGpmGpmCpmTpmGpmCpmGpmCpmTpmCpmCpmApmG +
Description miR30c
Design Morpholino +
Name MO_miR-30c_non_overlapping_loop  +
Sequence (25b) ACTCCCGGCCTCGGCTGCGCTCCAG
Target MiR-30 ( Danio rerio ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:42  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence-20865-20(MO-20miR-2D30c-20non-20overlapping-20loop)"