Browse wiki

Jump to: navigation, search
Sequence 874 (MO miR-375-1 overlapping loop)
Application Gene silencing +
Chemistry PmCpmGpmApmApmCpmGpmApmApmCpmApmApmApmApmCpmTpmGpmApmApmTpmCpmCpmApmCpmA +
Description miR378
Design Morpholino +
Name MO_miR-375-1_overlapping_loop  +
Sequence (24b) CGAACGAACAAAACTGAATCCACA
Target MiR-375 ( Danio rerio ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:20  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders