Browse wiki

Jump to: navigation, search
Sequence 886 (miR-99 , miR99)
Application Gene silencing +
Chemistry PmCpmApmCpmApmApmGpmApmTpmCpmGpmGpmApmTpmCpmTpmApmCpmGpmGpmGpmTpmT +
Description miR99
Design Morpholino +
Name miR-99 , miR99  +
Sequence (22b) CACAAGATCGGATCTACGGGTT
Target MiR-99 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:12  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders