Browse wiki
| Sequence 896 (myogenin) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Myogenin Ensembl: ENSMUSG00000026459 UniGene: Mm.16528 EntrezGene: 17928 Ensembl Chr1: 136186566 - 136189124 Strand: 1 GO terms: 0003677 0003705 0005634 0006355 0007275 0007517 0007519 0030154 0030528 0045449 0045944 0048741 |
| Design | ShRNA + |
| Name | myogenin + |
| Sequence | (64b) GATCCCCGTGAATGAGGCCTTCGAGGTTCAAGAGACCTCGAAGGCCTCATTCACTTTTTGGAAA |
| Target | Myog ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:48 + |
| hide properties that link here |
| No properties link to this page. |
