Browse wiki
Sequence 897 (siARD1.1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | N(alpha)-acetyltransferase 10, NatA catalytic subunit Ensembl: ENSG00000102030 |
Design | SiRNA + |
Name | siARD1.1 + |
Sequence | siRNA sense (21b) AGATGAAATACTACTTCTATT / siRNA antisense (21b) TAGAAGTAGTATTTCATCTGG |
Target | NAA10 (Homo sapiens) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:49 + |
hide properties that link here |
No properties link to this page. |