Browse wiki
| Sequence 925 (p50 2 , p502) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Nuclear factor of kappa light chain gene e … Nuclear factor of kappa light chain gene enhancer in B-cells 1, p105 Ensembl: ENSMUSG00000028163 UniGene: Mm.256765 EntrezGene: 18033 Ensembl Chr3: 135247621 - 135354511 Strand: -1 GO terms: 0003700 0004966 0005515 0005634 0005737 0006355 0006915 0007165 0007186 0016021 0016566 0045083 0045449 0045892 0045944 004853566 0045083 0045449 0045892 0045944 0048535 |
| Design | SiRNA + |
| Name | p50_2 , p502 + |
| Sequence | siRNA sense (21b) GGAGATGGACCTGAGCGTGTT / siRNA antisense (21b) CACGCTCAGGTCCATCTCCTT |
| Target | Nfkb1 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:07 + |
| hide properties that link here |
| No properties link to this page. |
