Browse wiki
Sequence 929 (p75NTR-3 , p75NTR3) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Nerve growth factor receptor (TNFR superfa … Nerve growth factor receptor (TNFR superfamily, member 16) Ensembl: ENSRNOG00000005392 UniGene: Rn.10980 EntrezGene: 24596 Ensembl Chr10: 84262802 - 84281006 Strand: -1 GO terms: 0005030 0005035 0005515 0005634 0005737 0005886 0006915 0006917 0007165 0007275 0007411 0007417 0009611 0016021 0016048 0021675 0030154 0042488 0043588 0048406 004863575 0030154 0042488 0043588 0048406 0048635 |
Design | SiRNA + |
Name | p75NTR-3 , p75NTR3 + |
Sequence | siRNA sense (21b) GAGACCAGGAGCATTGTACTT / siRNA antisense (21b) GTACAATGCTCCTGGTCTCTT |
Target | Ngfr ( Rattus norvegicus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:42 + |
hide properties that link here |
No properties link to this page. |