Browse wiki
| Sequence 930 (p75NTR-4 , p75NTR4) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Nerve growth factor receptor (TNFR superfa … Nerve growth factor receptor (TNFR superfamily, member 16) Ensembl: ENSRNOG00000005392 UniGene: Rn.10980 EntrezGene: 24596 Ensembl Chr10: 84262802 - 84281006 Strand: -1 GO terms: 0005030 0005035 0005515 0005634 0005737 0005886 0006915 0006917 0007165 0007275 0007411 0007417 0009611 0016021 0016048 0021675 0030154 0042488 0043588 0048406 004863575 0030154 0042488 0043588 0048406 0048635 |
| Design | SiRNA + |
| Name | p75NTR-4 , p75NTR4 + |
| Sequence | siRNA sense (21b) GAACCAGAGCCATGCACTCTT / siRNA antisense (21b) GAGTGCATGGCTCTGGTTCTT |
| Target | Ngfr ( Rattus norvegicus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:14 + |
| hide properties that link here |
| No properties link to this page. |
