Browse wiki
Sequence 934 (siNME2.2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | NME/NM23 nucleoside diphosphate kinase 2 Ensembl: ENSG00000011052 |
Design | SiRNA + |
Name | siNME2.2 + |
Sequence | siRNA sense (21b) GCACCTTCATCGCCATCAATT / siRNA antisense (21b) TTGATGGCGATGAAGGTGCGC |
Target | NME2 (Homo sapiens) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:11 + |
hide properties that link here |
No properties link to this page. |