Browse wiki

Jump to: navigation, search
Sequence 967 (Mal2 1)
Application Gene silencing +
Chemistry RNA +
Design ShRNA +
Name Mal2_1  +
Sequence (70b) AGATCTCCGGATGGGTCATGTTCGTGTTTCAAGAGAACACGAACATGACCCATCCTTTTTGGAAAAGCTT
Target NOV ( Canis lupus familiaris ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:57  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders