Browse wiki
Sequence 980 (shN2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Nuclear receptor subfamily 4, group A, mem … Nuclear receptor subfamily 4, group A, member 2 Ensembl: ENSMUSG00000026826 UniGene: Mm.3507 EntrezGene: 18227 Ensembl Chr2: 56959241 - 56976552 Strand: -1 GO terms: 0003677 0003700 0003707 0003708 0004879 0005515 0005634 0006350 0006355 0007399 0008270 0030182 0042053 0043565 0045944 004687270 0030182 0042053 0043565 0045944 0046872 |
Design | ShRNA + |
Name | shN2 + |
Sequence | (93b) AAAAAAGGGGCAGGTAGCTGTATTGCTAGTAGTCGCAAGCTTCCAACTACCAGCAACACAGCCACCTGCCCCGGTGTTTCGTCCTTTCCACAA |
Target | Nr4a2 ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:07 + |
hide properties that link here |
No properties link to this page. |