Browse wiki

Jump to: navigation, search
Sequence 980 (shN2)
Application Gene silencing +
Chemistry RNA +
Description Nuclear receptor subfamily 4, group A, memNuclear receptor subfamily 4, group A, member 2 Ensembl: ENSMUSG00000026826 UniGene: Mm.3507 EntrezGene: 18227 Ensembl Chr2: 56959241 - 56976552 Strand: -1 GO terms: 0003677 0003700 0003707 0003708 0004879 0005515 0005634 0006350 0006355 0007399 0008270 0030182 0042053 0043565 0045944 004687270 0030182 0042053 0043565 0045944 0046872
Design ShRNA +
Name shN2  +
Sequence (93b) AAAAAAGGGGCAGGTAGCTGTATTGCTAGTAGTCGCAAGCTTCCAACTACCAGCAACACAGCCACCTGCCCCGGTGTTTCGTCCTTTCCACAA
Target Nr4a2 ( Mus musculus ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:07  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders