Browse wiki
Sequence 993 (OGT1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | O-linked N-acetylglucosamine ( GlcNAc ) tr … O-linked N-acetylglucosamine ( GlcNAc ) transferase ( UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase ) Ensembl: ENSMUSG00000034160 UniGene: Mm.259191 EntrezGene: 108155 Ensembl ChrX: 98835403 - 98879688 Strand: 1 GO terms: 0005515 0005622 0005634 0005737 0006396 0006493 0008080 001675734 0005737 0006396 0006493 0008080 0016757 |
Design | SiRNA + |
Name | OGT1 + |
Sequence | siRNA sense (21b) GCAATCGAGCATTATCGACTT / siRNA antisense (21b) GTCGATAATGCTCGATTGCTT |
Target | Ogt ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:49 + |
hide properties that link here |
No properties link to this page. |