Browse wiki
Sequence 995 (PA-44 , PA44) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Design | SiRNA + |
Name | PA-44 , PA44 + |
Sequence | siRNA sense (21b) TGCTTCAATCCGATGATTGTT / siRNA antisense (21b) CAATCATCGGATTGAAGCATT |
Target | PA gene ( AY790294.1 ) ( Influenza A virus (A / swine / Korea / S175 / 2004( H1N1 )) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:01 + |
hide properties that link here |
No properties link to this page. |