Browse wiki
| Sequence 998 (PA-2110 , PA2110) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Design | SiRNA + |
| Name | PA-2110 , PA2110 + |
| Sequence | siRNA sense (21b) TGATCCCTGGGTTTTGCTTTT / siRNA antisense (21b) AAGCAAAACCCAGGGATCATT |
| Target | Polymerase acidic protein 2 (PA) gene ( AY619956.1 )( A / swine / Saskatchewan / 18789 / 02( H1N1 )) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:46 + |
| hide properties that link here |
| No properties link to this page. |
