Browse wiki
Sequence 1024(siPlk1-1 , siPlk11) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Polo-like kinase 1 ( Drosophila ) Ensembl … Polo-like kinase 1 ( Drosophila ) Ensembl: ENSG00000166851 UniGene: Hs.592049 EntrezGene: 5347 Ensembl Chr16: 23597702 - 23609189 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004713 0005515 0005524 0005634 0005813 0006468 0006813 0007067 0008283 0015272 0016020 001674013 0007067 0008283 0015272 0016020 0016740 |
Design | SiRNA + |
Name | siPlk1-1 , siPlk11 + |
Sequence | siRNA sense (21b) CCAGTGGTTCGAGAGACAGTT / siRNA antisense (21b) CTGTCTCTCGAACCACTGGTT |
Target | PLK1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:16 + |
hide properties that link here |
No properties link to this page. |