Browse wiki
| Sequence 1060(RasGRP1-RNAi274 , RasGRP1RNAi274) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | RAS guanyl releasing protein 1 ( calcium a … RAS guanyl releasing protein 1 ( calcium and DAG-regulated ) Ensembl: ENSG00000172575 UniGene: Hs.591127 EntrezGene: 10125 Ensembl Chr15: 36567590 - 36644224 Strand: -1 GO terms: 0005085 0005088 0005509 0005515 0005622 0005624 0007242 0007264 0007265 0008270 0008289 005105642 0007264 0007265 0008270 0008289 0051056 |
| Design | ShRNA + |
| Name | RasGRP1-RNAi274 , RasGRP1RNAi274 + |
| Sequence | (63b) GATCCCGTCATGCTGACCATGCACCTTCAAGAGAGGTGCATGGTCAGCATGACTTTTTGGAAA |
| Target | RASGRP1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:17 + |
| hide properties that link here |
| No properties link to this page. |
