Browse wiki
Sequence 1083(siRHOA.1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Ras homolog gene family, member A Ensembl … Ras homolog gene family, member A Ensembl: ENSG00000067560 UniGene: Hs.247077 EntrezGene: 387 Ensembl Chr3: 49371585 - 49424530 Strand: -1 GO terms: 0000166 0000287 0003924 0004871 0005515 0005525 0005622 0005737 0005856 0006886 0006913 0007165 0007264 0007266 0015031 0016020 0030036 0042346 004312366 0015031 0016020 0030036 0042346 0043123 |
Design | SiRNA + |
Name | siRHOA.1 + |
Sequence | siRNA sense (21b) CGGAATGATGAGCACACAATT / siRNA antisense (21b) TTGTGTGCTCATCATTCCGAA |
Target | RHOA (Homo sapiens) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:10 + |
hide properties that link here |
No properties link to this page. |