Browse wiki

Jump to: navigation, search
Sequence 1087(DBC2-y , DBC2y)
Application Gene silencing +
Chemistry RNA +
Description Rho-related BTB domain containing 2 Ensembl: ENSG00000008853 UniGene: Hs.372688 EntrezGene: 23221 Ensembl Chr8: 22913059 - 22933655 Strand: 1 GO terms: 0000166 0003677 0003700 0005515 0005525 0005622 0005634 0007264 0007275 0015031
Design SiRNA +
Name DBC2-y , DBC2y  +
Sequence siRNA sense (21b) GACCGTCGCTTTGCTTATGTT / siRNA antisense (21b) CATAAGCAAAGCGACGGTCTT
Target RHOBTB2 ( Homo sapiens ) +
Categories Sequence  +
Modification┬ádateThis property is a special property in this wiki. 2 March 2015 02:21:01  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders